Cswd40

Author: ihgm

August undefined, 2024

WebIn tea plants, some TFs, such as CsMYB1, CsWD40, and CsGL3, have been identified to be involved in trichome initiation by forming MBW complex [21 − 24]. The MBW complex also activates many repressors, such as R3 MYB TFs CAPRICE (CPC) and TRIPTYCHON (TRY), those repressors are then transferred into neighboring cells to repress the MBW ... WebFeb 15, 2024 · CsMYB1 interacts with CsGL3 and CsWD40 to form an MBW complex, which directly activates CsGL2 and then trichome development in tea plants. CsCPC …

A WD40-Repeat Protein From the Recretohalophyte - Frontiers

WebNov 12, 2024 · Similar results of enhanced trichome formation were seen in transgenic lines of CsWD40 from Camellia sinensis (Liu et al., 2024). TTG1 genes in different species thus show high conservation in controlling epidermis differentiation. The WD40-repeat domain may be responsible for this, but further transformation with WD40-repeat domain … WebView This Abstract Online; A WD40 Repeat Protein from Camellia sinensis Regulates Anthocyanin and Proanthocyanidin Accumulation through the Formation of MYB⁻bHLH⁻WD40 Ternary Complexes. Int J Mol Sci. 2024; 19(6) (ISSN: 1422-0067) Liu Y; Hou H; Jiang X; Wang P; Dai X; Chen W; Gao L; Xia T iowa firemen\u0027s convention

CsMYB1 integrates the regulation of trichome ... - Wiley Online …

WebNov 1, 2024 · Summary: The WD40-repeat proteins are a large family of scaffold molecules that assemble complexes in various cellular processes. Obtaining their structures is the … Web40 likes, 0 comments - Sanggar EBP (@sanggar_ebp) on Instagram on June 7, 2024: "Alhamdulilah Akad nikah neng @ayuufi Di Pondok Gede 7 Juni 2024 Makeup tim @sanggar ... iowa fire hydrant parts

National Center for Biotechnology Information

WebThe year 40 has 52 calendar weeks. 40 begins on 01/01/40 and ends on 31/12/40. The first calendar week in 40 begins on Monday, the 02/01/0040 and ends on Sunday, the … WebMar 6, 2016 · View Carrie Craig, MBA, ITILv4’s profile on LinkedIn, the world’s largest professional community. Carrie has 7 jobs listed on their profile. See the complete profile on ... opay pos machine imageWebJan 20, 2015 · OsWD40-99, LOC_Os04g11880, Os04g0195000. Genomic survey, expression profile and co-expression network analysis of OsWD40 family in rice., 2012, … opay solutions

"WebAug 23, 2016 · Based on further combined analysis with transcriptome data between two parents, CsARF19, CsWD40, CsEIN1, CsPPR, CsHEXO3, CsMDL, CsDJC77 and CsSMAX1 were predicted as potential candidate genes controlling parthenocarpy. A major-effect QTL Parth2.1 and six minor-effect QTLs mainly contribute to the genetic … " - Cswd40

Cswd40

A WD40 Repeat Protein from Camellia sinensis Regulates …

WebJul 14, 2024 · Overexpression of TTG1-like CsWD40 in tobacco resulted in a significant increase in anthocyanin content in the petals of the transgenic plants; when it was coexpressed with CsMYB5e in tobacco, both anthocyanin and proanthocyanidin content increased (Liu et al., 2024). WebEctopic expression of CsWD40 alone in tobacco resulted in a signiﬁcant increase in the anthocyanins of transgenic petals. CsWD40 was then coexpressed with CsMYB5e in tobacco plants to increase levels of both anthocyanins and PAs. Furthermore, gene expression analysis revealed that CsWD40 expression in tea plants could be induced by …

Did you know?

WebMay 1, 2024 · About this item . Product 1: MULTI-USE AEROSOL SPRAY: With a traditional spray nozzle, this unique lubricant comes in an industrial 16 oz. size. Offering easy to use application, this multi-purpose lubricant helps protect your tools as you tackle big jobs, so you’re ready for anything WebDownload scientific diagram CsMYC1 interacted with CsbHLH42, CsWD40, and itself. a Yeast two-hybrid assays validating the interaction of CsMYC1 with itself, CsbHLH42, and …

WebJul 1, 2024 · The CsbHLH42, CsMYC1, CsWD40, and CsTATA-box binding protein open reading frames were introduced into the PET-32a vector containing a histidine (HIS) tag … WebJan 28, 2024 · Yeast two-hybrid assay demonstrated CsMYB5b can interact directly with CsTT8 (an AtTT8 ortholog) and CsWD40 protein. Linking to the expression profiling of CsMYB5b and the PA accumulation pattern in tea plants suggest that the CsMYB5b acts as an important switch for the synthesis of monomeric catechins and PAs. Therefore, these …

WebNov 12, 2024 · Here, we identified a gene encoding a WD40-repeat protein with high sequence similarity to TTG1 of Arabidopsis by comparing … WebFeb 15, 2024 · Biochemical analyses and transgenic data showed that CsMYB1 interacted with CsGL3 and CsWD40 and formed a MYB-bHLH-WD40 (MBW) transcriptional complex to activate the trichome regulator genes CsGL2 and CsCPC, and the galloylated cis-catechins biosynthesis genes anthocyanidin reductase and serine carboxypeptidase-like …

Webcswd40-bamhⅠ-f cswd40-salⅠ-r atgggtaggagaccttgttg ttattgatcttgaagccaatc atggaggcgccgccgagtag tcagttctggggtattatttg atggagaattcgagccaag tcaaactttcagaagctgca ggggacaagtttgtacaaaaaagcag gctatgggtaggagaccttgttg ggggaccactttgtacaagaaagctg ggtcttgatcttgaagccaatc ggggacaagtttgtacaaaaaagcag

WebJul 1, 2024 · The CsbHLH42, CsMYC1, CsWD40, and CsTATA-box binding protein open reading frames were introduced into the PET-32a vector … iowa firefighters associationWebEctopic expression of CsWD40 alone in tobacco resulted in a signiﬁcant increase in the anthocyanins of transgenic petals. CsWD40 was then coexpressed with CsMYB5e in … opay registrationWebDownload scientific diagram Identification of the CsWD40 function in transgenic tobacco. (A) Analysis of CsWD40 transcription levels in the flowers by semiquantitative PCR. opay support linesWebOverexpression of TTG1like CsWD40 in tobacco resulted in a significant increase in anthocyanin content in the petals of the transgenic plants; when it was coexpressed with CsMYB5e in tobacco, both ... opay shut downWebJun 6, 2024 · To determine whether CsWD40 expression is related to temperature changes, we compared CsWD40 expression under low (10 °C) and high (50 °C) temperatures (Figure 7B). Our data indicated no … iowa fire service training booksWebIncludes: (1) Water Hose, (1) Ground Fault Circuit Interrupter Cord (GFCI), (1) Water Pressure Regulator Valve, (1) Spindle Wrench, (1) Lock Nut Wrench, (1) Contour Blade … opay stockWebJul 29, 2024 · CsWD40 could be induced significantly by ABA and sucrose stress, overexpression of CsWD40 can supplement the pigments lost in plants induced by sucrose, suggesting that CsWD40 enhanced the … iowa fire service training bureau testing